Transcript: Mouse NM_175145.3

Mus musculus transmembrane protein 127 (Tmem127), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmem127 (69470)
Length:
4401
CDS:
185..901

Additional Resources:

NCBI RefSeq record:
NM_175145.3
NBCI Gene record:
Tmem127 (69470)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175145.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125906 CTGAAGATTACTCGTCGGTAT pLKO.1 551 CDS 100% 4.050 5.670 N Tmem127 n/a
2 TRCN0000125908 CCCGCTTGGTTGCACATCCAT pLKO.1 335 CDS 100% 1.000 0.800 N Tmem127 n/a
3 TRCN0000125904 GCCAGAAAGAATGGTGAATAT pLKO.1 2489 3UTR 100% 13.200 9.240 N Tmem127 n/a
4 TRCN0000125905 CTTTGCTGTTAGCTTCTACTT pLKO.1 700 CDS 100% 4.950 3.465 N Tmem127 n/a
5 TRCN0000125907 CCCAGCAGAGTATGAGGTCAT pLKO.1 844 CDS 100% 4.050 2.835 N Tmem127 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175145.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.