Transcript: Mouse NM_175171.3

Mus musculus microtubule associated serine/threonine kinase family member 4 (Mast4), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mast4 (328329)
Length:
10671
CDS:
301..8157

Additional Resources:

NCBI RefSeq record:
NM_175171.3
NBCI Gene record:
Mast4 (328329)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175171.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360914 ACGTAACCATAACGTAGTAAG pLKO_005 8527 3UTR 100% 10.800 15.120 N Mast4 n/a
2 TRCN0000360913 TTATCGTTCTACTCCCGATTT pLKO_005 4233 CDS 100% 10.800 15.120 N Mast4 n/a
3 TRCN0000022930 CGCTCGGTTATTGGAGTGTTT pLKO.1 1731 CDS 100% 4.950 6.930 N Mast4 n/a
4 TRCN0000022932 CCCAGTTGATATGGCCAGAAT pLKO.1 2289 CDS 100% 4.950 3.960 N Mast4 n/a
5 TRCN0000199153 CCCATGCCGTTTCGGAAATGC pLKO.1 682 CDS 100% 1.650 1.320 N MAST4 n/a
6 TRCN0000360967 ACTGACATCCCTAGGTATATC pLKO_005 1828 CDS 100% 13.200 9.240 N Mast4 n/a
7 TRCN0000022929 CCGAAGTTTCTCCTGCTTAAA pLKO.1 4137 CDS 100% 13.200 9.240 N Mast4 n/a
8 TRCN0000022931 GCGCTTAGAAAGCACAGAGAA pLKO.1 3501 CDS 100% 4.950 3.465 N Mast4 n/a
9 TRCN0000360911 ACAGCAAGCTGGCCAATATTG pLKO_005 5330 CDS 100% 13.200 7.920 N Mast4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175171.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.