Transcript: Mouse NM_175179.4

Mus musculus APC membrane recruitment 1 (Amer1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Amer1 (72345)
Length:
8476
CDS:
272..3670

Additional Resources:

NCBI RefSeq record:
NM_175179.4
NBCI Gene record:
Amer1 (72345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175179.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426122 GAAACCTAGCCAAGTAGTTAT pLKO_005 3654 CDS 100% 13.200 18.480 N Amer1 n/a
2 TRCN0000144779 CCCAATAGTGATGAAGGTTAT pLKO.1 1724 CDS 100% 10.800 8.640 N AMER1 n/a
3 TRCN0000414926 CAATAGTGATGAAGGTTATTA pLKO_005 1726 CDS 100% 15.000 10.500 N Amer1 n/a
4 TRCN0000122094 CCAATAGTGATGAAGGTTATT pLKO.1 1725 CDS 100% 13.200 9.240 N AMER1 n/a
5 TRCN0000198974 GACAGGTTGTGGTGACATTAT pLKO.1 1243 CDS 100% 13.200 9.240 N Amer1 n/a
6 TRCN0000181801 GATCAGCTAAGCCTCTTGTTT pLKO.1 1187 CDS 100% 5.625 3.938 N Amer1 n/a
7 TRCN0000198986 GAATCTGTACTCTGCCTAGTT pLKO.1 465 CDS 100% 4.950 3.465 N Amer1 n/a
8 TRCN0000182686 GCTTTGACTCACTGACAGGTT pLKO.1 1230 CDS 100% 2.640 1.848 N Amer1 n/a
9 TRCN0000198767 CCAAAGGAGCATCAACTTCTA pLKO.1 303 CDS 100% 4.950 2.970 N Amer1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175179.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.