Transcript: Mouse NM_175246.4

Mus musculus Smad nuclear interacting protein 1 (Snip1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Snip1 (76793)
Length:
2344
CDS:
61..1212

Additional Resources:

NCBI RefSeq record:
NM_175246.4
NBCI Gene record:
Snip1 (76793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175246.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120768 CCTACATTATCGACCTTGGCT pLKO.1 998 CDS 100% 0.750 0.600 N Snip1 n/a
2 TRCN0000366306 GAGGGTGAAGCCCTACATTAT pLKO_005 987 CDS 100% 13.200 9.240 N Snip1 n/a
3 TRCN0000375040 TCTGAACAGTCTCACCAATTA pLKO_005 1398 3UTR 100% 13.200 9.240 N Snip1 n/a
4 TRCN0000366357 TTGAGTCATAGAAGTTGATTT pLKO_005 1663 3UTR 100% 13.200 9.240 N Snip1 n/a
5 TRCN0000366308 GGCTCAGGCAATGGAACATTC pLKO_005 1015 CDS 100% 10.800 7.560 N Snip1 n/a
6 TRCN0000120767 CCACACTTCCAGTTCATCTTT pLKO.1 2038 3UTR 100% 5.625 3.938 N Snip1 n/a
7 TRCN0000375094 AGGTACTTCCAGTCATGTACA pLKO_005 824 CDS 100% 4.950 3.465 N Snip1 n/a
8 TRCN0000375038 AGTCACCACGGACCAAGAGAA pLKO_005 305 CDS 100% 4.950 3.465 N Snip1 n/a
9 TRCN0000120771 CAGTAGCAGAGAATATGTCTT pLKO.1 1107 CDS 100% 4.950 3.465 N Snip1 n/a
10 TRCN0000120770 AGAAATGGTATCTGACAGCTA pLKO.1 1191 CDS 100% 2.640 1.848 N Snip1 n/a
11 TRCN0000120769 AGACGTACTTAAATTTGGGTT pLKO.1 1086 CDS 100% 2.640 1.848 N Snip1 n/a
12 TRCN0000375041 GCCCGTTAAAGAGAAACCAAG pLKO_005 675 CDS 100% 4.050 2.430 N Snip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175246.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.