Transcript: Mouse NM_175286.4

Mus musculus taperin (Tprn), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tprn (97031)
Length:
2825
CDS:
91..2340

Additional Resources:

NCBI RefSeq record:
NM_175286.4
NBCI Gene record:
Tprn (97031)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175286.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283282 GTCAATCGCTCGCTTTCTAAT pLKO_005 838 CDS 100% 13.200 18.480 N Tprn n/a
2 TRCN0000265108 CCAGAGTGCTGTCGGAAATTT pLKO_005 2604 3UTR 100% 15.000 10.500 N Tprn n/a
3 TRCN0000265110 CCCTTCAGGAGCCACACTTAA pLKO_005 1748 CDS 100% 13.200 9.240 N Tprn n/a
4 TRCN0000190326 CCAGTCACCTTCATTGATGAA pLKO.1 1564 CDS 100% 4.950 3.465 N Tprn n/a
5 TRCN0000265109 GACTTCCAGTCACCTTCATTG pLKO_005 1559 CDS 100% 10.800 6.480 N Tprn n/a
6 TRCN0000201450 CCATACTGTCTCATCTGTGAT pLKO.1 2556 3UTR 100% 4.950 2.970 N Tprn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175286.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.