Transcript: Mouse NM_175290.4

Mus musculus NLR family, pyrin domain containing 4F (Nlrp4f), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Nlrp4f (97895)
Length:
3527
CDS:
126..2939

Additional Resources:

NCBI RefSeq record:
NM_175290.4
NBCI Gene record:
Nlrp4f (97895)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175290.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119684 CGATTGTTGGAAACCCAAATT pLKO.1 391 CDS 100% 13.200 18.480 N Nlrp4f n/a
2 TRCN0000119685 GCATCCAACAATTTGAATCAA pLKO.1 2379 CDS 100% 5.625 3.938 N Nlrp4f n/a
3 TRCN0000119686 GTGAAATAACTGATGCCAGTA pLKO.1 2812 CDS 100% 4.050 2.835 N Nlrp4f n/a
4 TRCN0000119682 GAGAGGCCATTCAAAGATATT pLKO.1 3207 3UTR 100% 13.200 7.920 N Nlrp4f n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175290.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.