Transcript: Mouse NM_175303.4

Mus musculus sal-like 4 (Drosophila) (Sall4), transcript variant a, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Sall4 (99377)
Length:
5104
CDS:
173..3376

Additional Resources:

NCBI RefSeq record:
NM_175303.4
NBCI Gene record:
Sall4 (99377)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175303.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097820 CCTCCAACATTTATCCGAGCA pLKO.1 2672 CDS 100% 2.160 3.024 N Sall4 n/a
2 TRCN0000097821 CAGCCCACCTTTGTCAAAGTT pLKO.1 2693 CDS 100% 5.625 3.938 N Sall4 n/a
3 TRCN0000097822 GAAGCCTTTCGTGTGTAACAT pLKO.1 2887 CDS 100% 5.625 3.938 N Sall4 n/a
4 TRCN0000097824 GCCCACCTTTGTCAAAGTTGA pLKO.1 2695 CDS 100% 4.950 3.465 N Sall4 n/a
5 TRCN0000021876 GCCTTGAAACAAGCCAAGCTA pLKO.1 1037 CDS 100% 3.000 2.100 N SALL4 n/a
6 TRCN0000097823 CCAGTACACCAGCGTCCTGAA pLKO.1 3112 CDS 100% 1.350 0.945 N Sall4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175303.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.