Transcript: Mouse NM_175317.3

Mus musculus elongation factor like GPTase 1 (Efl1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Efl1 (101592)
Length:
3637
CDS:
81..3464

Additional Resources:

NCBI RefSeq record:
NM_175317.3
NBCI Gene record:
Efl1 (101592)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175317.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201967 CCGCCTGATAGTGGAACTAAA pLKO.1 527 CDS 100% 13.200 18.480 N Efl1 n/a
2 TRCN0000236500 CACGACATTCAGACCCTAAAG pLKO_005 1075 CDS 100% 10.800 15.120 N EFL1 n/a
3 TRCN0000217942 GTTGACCAGATCTGGTCATTT pLKO.1 2538 CDS 100% 1.320 1.848 N Efl1 n/a
4 TRCN0000215610 GATTGTCTTATATCCAGTAAT pLKO.1 189 CDS 100% 13.200 9.240 N Efl1 n/a
5 TRCN0000189817 GCACGACATTCAGACCCTAAA pLKO.1 1074 CDS 100% 10.800 7.560 N Efl1 n/a
6 TRCN0000202208 CCTGTCACGTTGGAGATGAAA pLKO.1 2863 CDS 100% 5.625 3.938 N Efl1 n/a
7 TRCN0000191557 GCTCCAGTTATTATCTTTGTT pLKO.1 1302 CDS 100% 5.625 3.938 N Efl1 n/a
8 TRCN0000193045 GCAGCTAATTGCTACCATGAA pLKO.1 2978 CDS 100% 4.950 3.465 N Efl1 n/a
9 TRCN0000189731 GCCATTCATCAGAAGACCCAA pLKO.1 2451 CDS 100% 2.640 1.848 N Efl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175317.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.