Transcript: Mouse NM_175324.3

Mus musculus acyl-Coenzyme A dehydrogenase family, member 11 (Acad11), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Acad11 (102632)
Length:
3348
CDS:
59..2398

Additional Resources:

NCBI RefSeq record:
NM_175324.3
NBCI Gene record:
Acad11 (102632)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175324.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247815 GCAGAACGTGCTGCTATATAT pLKO_005 470 CDS 100% 15.000 21.000 N Acad11 n/a
2 TRCN0000247814 CTGAGGAGATCCGTAACTAAT pLKO_005 2938 3UTR 100% 13.200 18.480 N Acad11 n/a
3 TRCN0000247812 GTTCGGCTACATGGATAATAT pLKO_005 1816 CDS 100% 15.000 12.000 N Acad11 n/a
4 TRCN0000247816 CGTTCCTGCCAGCAACTTAAT pLKO_005 1876 CDS 100% 13.200 10.560 N Acad11 n/a
5 TRCN0000247813 GGGTCGGATCTTTCGTGATTT pLKO_005 427 CDS 100% 13.200 9.240 N Acad11 n/a
6 TRCN0000201181 GATTGCTGAAGAGACAGGAAA pLKO.1 1408 CDS 100% 4.950 3.465 N Acad11 n/a
7 TRCN0000191597 GCATCCAAATAAACACAGTAA pLKO.1 3196 3UTR 100% 4.950 3.465 N Acad11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175324.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.