Transcript: Mouse NM_175326.5

Mus musculus RIKEN cDNA D330045A20 gene (D330045A20Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
D330045A20Rik (102871)
Length:
3738
CDS:
130..2682

Additional Resources:

NCBI RefSeq record:
NM_175326.5
NBCI Gene record:
D330045A20Rik (102871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175326.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215552 GAAAGTATTCCACGGAAATTT pLKO.1 2233 CDS 100% 15.000 21.000 N D330045A20Rik n/a
2 TRCN0000264384 GAAAGTATTCCACGGAAATTT pLKO_005 2233 CDS 100% 15.000 21.000 N D330045A20Rik n/a
3 TRCN0000264383 TTCCCTATAACCCTATAATTT pLKO_005 3544 3UTR 100% 15.000 21.000 N D330045A20Rik n/a
4 TRCN0000128185 CTGAAAGTATTCCACGGAAAT pLKO.1 2231 CDS 100% 10.800 8.640 N RADX n/a
5 TRCN0000264385 CACGGTTATTGGTGGATATTA pLKO_005 1629 CDS 100% 15.000 10.500 N D330045A20Rik n/a
6 TRCN0000264382 GCATCGCAAATAGATACATTT pLKO_005 2458 CDS 100% 13.200 9.240 N D330045A20Rik n/a
7 TRCN0000283020 GGGATAATTACTGCTATAAAG pLKO_005 1789 CDS 100% 13.200 9.240 N D330045A20Rik n/a
8 TRCN0000202295 GCTTGAGAGACCACCTACATT pLKO.1 2195 CDS 100% 5.625 3.938 N D330045A20Rik n/a
9 TRCN0000191324 CCCTTTATTGTGATTTCCAAT pLKO.1 3217 3UTR 100% 4.950 3.465 N D330045A20Rik n/a
10 TRCN0000191805 GCTTACACAATTTAACAGCTT pLKO.1 2988 3UTR 100% 2.640 1.848 N D330045A20Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175326.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.