Transcript: Mouse NM_175369.4

Mus musculus coiled-coil domain containing 122 (Ccdc122), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ccdc122 (108811)
Length:
1780
CDS:
249..1121

Additional Resources:

NCBI RefSeq record:
NM_175369.4
NBCI Gene record:
Ccdc122 (108811)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175369.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179353 GAAGCTCAAATTGAGTCCTTA pLKO.1 531 CDS 100% 4.950 6.930 N Ccdc122 n/a
2 TRCN0000247484 CTCAAATTGAGTCCTTATATT pLKO_005 535 CDS 100% 15.000 12.000 N Ccdc122 n/a
3 TRCN0000215670 GATGTAAGTTGCTGAGATAAA pLKO.1 1425 3UTR 100% 13.200 10.560 N Ccdc122 n/a
4 TRCN0000247488 ATGTAAGTTGCTGAGATAAAT pLKO_005 1426 3UTR 100% 15.000 10.500 N Ccdc122 n/a
5 TRCN0000247486 GACAATGAAAGAAGATCTTAT pLKO_005 740 CDS 100% 13.200 9.240 N Ccdc122 n/a
6 TRCN0000247487 GATGAACAAGATTCAGTTAAA pLKO_005 971 CDS 100% 13.200 9.240 N Ccdc122 n/a
7 TRCN0000180494 GCTGCAATGGAGAACTCTAAA pLKO.1 492 CDS 100% 13.200 9.240 N Ccdc122 n/a
8 TRCN0000216508 CATAAGAGATATGATGCAATT pLKO.1 930 CDS 100% 10.800 7.560 N Ccdc122 n/a
9 TRCN0000247485 CATAAGAGATATGATGCAATT pLKO_005 930 CDS 100% 10.800 7.560 N Ccdc122 n/a
10 TRCN0000179406 GCATTGTCAGATGAACAAGAT pLKO.1 962 CDS 100% 4.950 3.465 N Ccdc122 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175369.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.