Transcript: Mouse NM_175370.5

Mus musculus amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 (human) (Als2cr12), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Als2cr12 (108812)
Length:
1575
CDS:
121..1272

Additional Resources:

NCBI RefSeq record:
NM_175370.5
NBCI Gene record:
Als2cr12 (108812)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175370.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180148 CCATGTGTTTCAGGATAGCAT pLKO.1 786 CDS 100% 3.000 2.400 N Als2cr12 n/a
2 TRCN0000179211 GAAGAGTATGTTCCATGTGTT pLKO.1 774 CDS 100% 4.950 3.465 N Als2cr12 n/a
3 TRCN0000179609 GCTGAGTTGATGGCAATAATA pLKO.1 526 CDS 100% 15.000 9.000 N Als2cr12 n/a
4 TRCN0000216568 GTCTTGAGCAAAGTCAAATTT pLKO.1 466 CDS 100% 15.000 9.000 N Als2cr12 n/a
5 TRCN0000181016 GCAAGCATCGTAGGTAACTAA pLKO.1 1376 3UTR 100% 5.625 3.375 N Als2cr12 n/a
6 TRCN0000184168 CGTTCCTGAACACAACAGCAA pLKO.1 1349 3UTR 100% 2.640 1.320 Y Als2cr12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175370.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.