Transcript: Mouse NM_175384.4

Mus musculus cell division cycle associated 2 (Cdca2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cdca2 (108912)
Length:
3568
CDS:
91..3039

Additional Resources:

NCBI RefSeq record:
NM_175384.4
NBCI Gene record:
Cdca2 (108912)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175384.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216356 GGACCTTTAGAATGACTTATT pLKO.1 3347 3UTR 100% 13.200 9.240 N Cdca2 n/a
2 TRCN0000200498 CTTCGTTCTGTGTTGAAGAAA pLKO.1 1060 CDS 100% 5.625 3.938 N Cdca2 n/a
3 TRCN0000192484 CAGAGTTCATACCTGGAACAA pLKO.1 2539 CDS 100% 4.950 3.465 N Cdca2 n/a
4 TRCN0000202108 CGCTTCAGTGCATTGCACATT pLKO.1 3128 3UTR 100% 4.950 3.465 N Cdca2 n/a
5 TRCN0000192862 GCTTCGTTCTGTGTTGAAGAA pLKO.1 1059 CDS 100% 4.950 3.465 N Cdca2 n/a
6 TRCN0000189506 CAGGCACTAACACTTGCAGTT pLKO.1 1490 CDS 100% 4.050 2.835 N Cdca2 n/a
7 TRCN0000190001 GCCAAGAGACATTGCATCGAA pLKO.1 1770 CDS 100% 3.000 2.100 N Cdca2 n/a
8 TRCN0000138544 CCACAGTAACCGTAGAGCAAT pLKO.1 269 CDS 100% 4.950 3.960 N CDCA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175384.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.