Transcript: Mouse NM_175397.4

Mus musculus Sp110 nuclear body protein (Sp110), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Sp110 (109032)
Length:
1947
CDS:
210..1547

Additional Resources:

NCBI RefSeq record:
NM_175397.4
NBCI Gene record:
Sp110 (109032)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175397.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225826 ACGTCCGAACTGGTCAAATTC pLKO_005 962 CDS 100% 13.200 6.600 Y Sp110 n/a
2 TRCN0000194101 GATGAACTCCTGACCTGATAT pLKO.1 1550 3UTR 100% 13.200 6.600 Y Sp110 n/a
3 TRCN0000225827 GATGAACTCCTGACCTGATAT pLKO_005 1550 3UTR 100% 13.200 6.600 Y Sp110 n/a
4 TRCN0000218876 AGCTTCAGAAACGTTGGTTAT pLKO_005 513 CDS 100% 10.800 5.400 Y Sp110 n/a
5 TRCN0000225825 CAACCGCACAGCCAATCATTG pLKO_005 691 CDS 100% 10.800 5.400 Y Sp110 n/a
6 TRCN0000225824 CAAGGTCAACCTCCGGGAATA pLKO_005 467 CDS 100% 10.800 5.400 Y Sp110 n/a
7 TRCN0000176063 GCTCTTCTCCAGCATTTCATA pLKO.1 240 CDS 100% 5.625 2.813 Y Sp110 n/a
8 TRCN0000174047 CCAAGAATGACGCTGTGGATT pLKO.1 1261 CDS 100% 4.950 2.475 Y Sp110 n/a
9 TRCN0000193214 CTTTGTGGAAAGATGACTCAT pLKO.1 1087 CDS 100% 4.950 2.475 Y Sp110 n/a
10 TRCN0000173786 CAGATGAACTCCTGACCTGAT pLKO.1 1548 CDS 100% 4.050 2.025 Y Sp110 n/a
11 TRCN0000193944 CCAATCATTGAGATCCTGGAT pLKO.1 702 CDS 100% 2.640 1.320 Y Sp110 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175397.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.