Transcript: Mouse NM_175427.4

Mus musculus family with sequence similarity 163, member B (Fam163b), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fam163b (109349)
Length:
2962
CDS:
342..845

Additional Resources:

NCBI RefSeq record:
NM_175427.4
NBCI Gene record:
Fam163b (109349)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175427.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282963 TTCCAACCGCAACCTCGTGTT pLKO_005 518 CDS 100% 4.050 5.670 N Fam163b n/a
2 TRCN0000264272 GAAGTGAGAAGATGGATAATG pLKO_005 1132 3UTR 100% 13.200 9.240 N Fam163b n/a
3 TRCN0000264274 ACTGTGATTCTGCTCTGTATC pLKO_005 384 CDS 100% 10.800 7.560 N Fam163b n/a
4 TRCN0000264273 AGCCAGAGGACGAAGACTTTG pLKO_005 658 CDS 100% 10.800 7.560 N Fam163b n/a
5 TRCN0000189860 GCATCTTGGCAACTGTGATTC pLKO.1 373 CDS 100% 10.800 7.560 N Fam163b n/a
6 TRCN0000264275 CTGCTGCAAGAAGGACGAATC pLKO_005 440 CDS 100% 6.000 4.200 N Fam163b n/a
7 TRCN0000192380 CAGGAAGTGAGAAGATGGATA pLKO.1 1129 3UTR 100% 4.950 3.465 N Fam163b n/a
8 TRCN0000189982 GCAACTGTGATTCTGCTCTGT pLKO.1 381 CDS 100% 2.640 1.848 N Fam163b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175427.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.