Transcript: Mouse NM_175440.4

Mus musculus protease, serine 27 (Prss27), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Prss27 (213171)
Length:
1149
CDS:
65..1051

Additional Resources:

NCBI RefSeq record:
NM_175440.4
NBCI Gene record:
Prss27 (213171)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175440.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032236 CACTTCGGACATATCCATATA pLKO.1 310 CDS 100% 13.200 18.480 N Prss27 n/a
2 TRCN0000032237 GCCGGTGACCTTCACCAATTA pLKO.1 469 CDS 100% 13.200 9.240 N Prss27 n/a
3 TRCN0000032235 CCCAGTGAACAAGACCGACTA pLKO.1 569 CDS 100% 4.050 2.835 N Prss27 n/a
4 TRCN0000032238 CCAGGACCACACGCCTTGTAT pLKO.1 365 CDS 100% 1.875 1.313 N Prss27 n/a
5 TRCN0000032234 CCGTGTGACTTCTCATCACAA pLKO.1 862 CDS 100% 0.495 0.347 N Prss27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175440.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.