Transcript: Mouse NM_175441.5

Mus musculus myosin light chain kinase 3 (Mylk3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Mylk3 (213435)
Length:
3070
CDS:
151..2538

Additional Resources:

NCBI RefSeq record:
NM_175441.5
NBCI Gene record:
Mylk3 (213435)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175441.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362043 TACCTGCATCAGCACTATATC pLKO_005 1954 CDS 100% 0.000 0.000 N Mylk3 n/a
2 TRCN0000024320 CGTAAACTTGATCCAACTTTA pLKO.1 1785 CDS 100% 13.200 10.560 N Mylk3 n/a
3 TRCN0000024319 CCTGGAATTGTCCGTAGCAAT pLKO.1 933 CDS 100% 4.950 3.960 N Mylk3 n/a
4 TRCN0000024321 GCTGGGATTTCGATGCTGATA pLKO.1 2261 CDS 100% 4.950 3.960 N Mylk3 n/a
5 TRCN0000378507 AGATTGGCGCTTTGCTATTAT pLKO_005 2625 3UTR 100% 15.000 10.500 N Mylk3 n/a
6 TRCN0000361987 CAGCCAGACAGGGCATCAAAT pLKO_005 2013 CDS 100% 13.200 9.240 N Mylk3 n/a
7 TRCN0000024323 CCAAGAAGATGTCACAGAGAA pLKO.1 285 CDS 100% 4.950 2.970 N Mylk3 n/a
8 TRCN0000024322 AGTGACATTCACAGTGGTGAT pLKO.1 1108 CDS 100% 4.050 2.430 N Mylk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175441.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.