Transcript: Mouse NM_175452.4

Mus musculus gap junction protein, gamma 2 (Gjc2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Gjc2 (118454)
Length:
2206
CDS:
101..1423

Additional Resources:

NCBI RefSeq record:
NM_175452.4
NBCI Gene record:
Gjc2 (118454)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175452.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068905 CGTGGTTAGCTGTCTATGCTT pLKO.1 913 CDS 100% 3.000 4.200 N Gjc2 n/a
2 TRCN0000068907 TCAGGAACAACTGGCCACTAA pLKO.1 1336 CDS 100% 4.950 3.465 N Gjc2 n/a
3 TRCN0000068906 TCTGTCATGTACCTGGGCTAT pLKO.1 371 CDS 100% 4.050 2.835 N Gjc2 n/a
4 TRCN0000068904 GCAATCCAAGTTCACCTGCAA pLKO.1 250 CDS 100% 2.640 1.848 N Gjc2 n/a
5 TRCN0000068903 CCATCTATTCAGATGAGCAAT pLKO.1 234 CDS 100% 0.495 0.347 N Gjc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175452.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.