Transcript: Mouse NM_175473.3

Mus musculus Fraser extracellular matrix complex subunit 1 (Fras1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fras1 (231470)
Length:
15848
CDS:
859..12891

Additional Resources:

NCBI RefSeq record:
NM_175473.3
NBCI Gene record:
Fras1 (231470)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175473.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114803 CGGTTGTGTATTCGCTCAATA pLKO.1 11822 CDS 100% 13.200 18.480 N Fras1 n/a
2 TRCN0000114802 GCCCGGTATCACTGAACAATA pLKO.1 9438 CDS 100% 13.200 18.480 N Fras1 n/a
3 TRCN0000114804 GCCTCTATTTATCAGTTCCAT pLKO.1 4675 CDS 100% 3.000 2.400 N Fras1 n/a
4 TRCN0000114805 GCTGGCGGAATTTGCAGTATT pLKO.1 897 CDS 100% 13.200 9.240 N Fras1 n/a
5 TRCN0000114801 GCACACAACTTGCCTTTGTTT pLKO.1 13960 3UTR 100% 5.625 3.938 N Fras1 n/a
6 TRCN0000373767 CTGCAGAAGCTGCCAGAATTG pLKO_005 3444 CDS 100% 10.800 7.560 N ISM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175473.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.