Transcript: Mouse NM_175485.4

Mus musculus protogenin (Prtg), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Prtg (235472)
Length:
8764
CDS:
184..3759

Additional Resources:

NCBI RefSeq record:
NM_175485.4
NBCI Gene record:
Prtg (235472)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175485.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366868 CAATAGCTACGGTCCTATAAT pLKO_005 3276 CDS 100% 15.000 21.000 N Prtg n/a
2 TRCN0000366866 CCCTAAGACCTCCCGAAATTA pLKO_005 1715 CDS 100% 15.000 12.000 N Prtg n/a
3 TRCN0000375811 TGCAGCTACTATAGCTCATAA pLKO_005 783 CDS 100% 13.200 10.560 N Prtg n/a
4 TRCN0000375809 CATTCAAATGGCAGGATTAAA pLKO_005 1267 CDS 100% 15.000 10.500 N Prtg n/a
5 TRCN0000375747 TTCTACATGCCAACCATTATA pLKO_005 859 CDS 100% 15.000 10.500 N Prtg n/a
6 TRCN0000366867 GATATCCCAGACCCATCATTT pLKO_005 944 CDS 100% 13.200 9.240 N Prtg n/a
7 TRCN0000114113 CGACAGCAACTATACTTTCTA pLKO.1 1620 CDS 100% 5.625 3.938 N Prtg n/a
8 TRCN0000114111 GCTTGACTGGACTCTAAGATA pLKO.1 3963 3UTR 100% 5.625 3.938 N Prtg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175485.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.