Transcript: Mouse NM_175515.5

Mus musculus inturned planar cell polarity protein (Intu), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Intu (380614)
Length:
6387
CDS:
98..2926

Additional Resources:

NCBI RefSeq record:
NM_175515.5
NBCI Gene record:
Intu (380614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175515.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252808 CACTATAGTACTCGTTAAATA pLKO_005 3028 3UTR 100% 15.000 21.000 N Intu n/a
2 TRCN0000216905 GGATTGGCCAGCTGATAATAT pLKO.1 1773 CDS 100% 15.000 21.000 N Intu n/a
3 TRCN0000252807 CGCACCTCGTCTGGATCATTT pLKO_005 1390 CDS 100% 13.200 18.480 N Intu n/a
4 TRCN0000252806 GGAACCTGAAGGGAGATATTT pLKO_005 1858 CDS 100% 15.000 10.500 N Intu n/a
5 TRCN0000252810 AGTTGGAAGTCTATGACATAA pLKO_005 2442 CDS 100% 13.200 9.240 N Intu n/a
6 TRCN0000252809 GAGCATTCGGAGCCTACAAAT pLKO_005 2681 CDS 100% 13.200 9.240 N Intu n/a
7 TRCN0000191191 CGTTAAATACTGAGATGCAAT pLKO.1 3040 3UTR 100% 4.950 3.465 N Intu n/a
8 TRCN0000079943 CCTGCTTTCTTATAGAACCAA pLKO.1 4472 3UTR 100% 3.000 1.500 Y Spint1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175515.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.