Transcript: Mouse NM_175561.4

Mus musculus pecanex homolog 2 (Pcnx2), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pcnx2 (270109)
Length:
7254
CDS:
237..6605

Additional Resources:

NCBI RefSeq record:
NM_175561.4
NBCI Gene record:
Pcnx2 (270109)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175561.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193358 CTATAGCATCATCGATAACAA pLKO.1 4703 CDS 100% 5.625 7.875 N Pcnx2 n/a
2 TRCN0000176209 GCATGGATAATTCCAACACAA pLKO.1 4264 CDS 100% 4.950 6.930 N Pcnx2 n/a
3 TRCN0000173946 GCCAGTTACCACAGAACTCTT pLKO.1 884 CDS 100% 4.950 6.930 N Pcnx2 n/a
4 TRCN0000175416 CAGGGACCACTTAATAGTATT pLKO.1 3026 CDS 100% 13.200 10.560 N Pcnx2 n/a
5 TRCN0000175190 CGAACCCATTAAGATAGTAAT pLKO.1 1331 CDS 100% 13.200 10.560 N Pcnx2 n/a
6 TRCN0000173370 GTTCTGGGAGAGAAGCTATAA pLKO.1 4235 CDS 100% 13.200 9.240 N Pcnx2 n/a
7 TRCN0000175415 CAGACCCATCTATTTCTGTAT pLKO.1 2897 CDS 100% 4.950 3.465 N Pcnx2 n/a
8 TRCN0000173223 CAAGAATGAATCCCTGCTGAA pLKO.1 4832 CDS 100% 4.050 2.835 N Pcnx2 n/a
9 TRCN0000175804 GCTGGTTAAATTAGAACAGCT pLKO.1 6884 3UTR 100% 2.640 1.848 N Pcnx2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175561.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.