Transcript: Human NM_175575.6

Homo sapiens WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 (WFIKKN2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
WFIKKN2 (124857)
Length:
3417
CDS:
353..2083

Additional Resources:

NCBI RefSeq record:
NM_175575.6
NBCI Gene record:
WFIKKN2 (124857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175575.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373965 CACCAGCTTGCTCAGATATTC pLKO_005 2336 3UTR 100% 13.200 18.480 N WFIKKN2 n/a
2 TRCN0000073596 CCTCAACCACTTTGAGACCTA pLKO.1 1444 CDS 100% 0.264 0.370 N WFIKKN2 n/a
3 TRCN0000373884 TGCCCAGCTGGTCATCTATAA pLKO_005 1159 CDS 100% 13.200 9.240 N WFIKKN2 n/a
4 TRCN0000373886 CATCACACTGGCCGTTGTAAC pLKO_005 853 CDS 100% 10.800 7.560 N WFIKKN2 n/a
5 TRCN0000073595 GAGGTCCTAAAGGATGAGAAA pLKO.1 1811 CDS 100% 4.950 3.465 N WFIKKN2 n/a
6 TRCN0000073594 GCCCGCTACATGGACGTGAAA pLKO.1 623 CDS 100% 1.650 1.155 N WFIKKN2 n/a
7 TRCN0000073597 CCAGTGCCAGTCCTTTGTCTA pLKO.1 1579 CDS 100% 4.950 2.970 N WFIKKN2 n/a
8 TRCN0000073593 GCAGGAGAAATGAAGGAAGAT pLKO.1 3000 3UTR 100% 4.950 2.970 N WFIKKN2 n/a
9 TRCN0000079973 CCCGTGTGTAAGTGCAAAGAT pLKO.1 740 CDS 100% 5.625 3.938 N Wfikkn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175575.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.