Transcript: Human NM_175710.2

Homo sapiens complement C3b/C4b receptor 1 like (CR1L), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CR1L (1379)
Length:
1829
CDS:
102..1811

Additional Resources:

NCBI RefSeq record:
NM_175710.2
NBCI Gene record:
CR1L (1379)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175710.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247716 TAGCATCAGCAGAGAGTATTT pLKO_005 611 CDS 100% 13.200 18.480 N CR1L n/a
2 TRCN0000257671 GTCCTCCTTCTCCGATCAATG pLKO_005 185 CDS 100% 10.800 8.640 N CR1L n/a
3 TRCN0000257642 CTGTTTGTGACAGAATTATTT pLKO_005 553 CDS 100% 15.000 10.500 N CR1L n/a
4 TRCN0000247718 CCTCAGAGGATCTACGTATTT pLKO_005 1070 CDS 100% 13.200 9.240 N CR1L n/a
5 TRCN0000247717 TTCCAGTGTGTGAACGTAAAT pLKO_005 1315 CDS 100% 13.200 9.240 N CR1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175710.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.