Transcript: Human NM_176806.4

Homo sapiens molybdenum cofactor synthesis 2 (MOCS2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MOCS2 (4338)
Length:
3705
CDS:
29..295

Additional Resources:

NCBI RefSeq record:
NM_176806.4
NBCI Gene record:
MOCS2 (4338)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_176806.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045687 TGAGCCATCTAGGAAAGATAT pLKO.1 302 3UTR 100% 13.200 9.240 N MOCS2 n/a
2 TRCN0000291649 TGAGCCATCTAGGAAAGATAT pLKO_005 302 3UTR 100% 13.200 9.240 N MOCS2 n/a
3 TRCN0000045685 GCTGTGAGCTATGCCATTGAT pLKO.1 663 3UTR 100% 5.625 3.938 N MOCS2 n/a
4 TRCN0000291650 GCTGTGAGCTATGCCATTGAT pLKO_005 663 3UTR 100% 5.625 3.938 N MOCS2 n/a
5 TRCN0000045684 CCAGTGTCAGAAGCAAGCATA pLKO.1 600 3UTR 100% 4.950 3.465 N MOCS2 n/a
6 TRCN0000291712 CCAGTGTCAGAAGCAAGCATA pLKO_005 600 3UTR 100% 4.950 3.465 N MOCS2 n/a
7 TRCN0000045683 CCCTATTTGTAGGGACTACAA pLKO.1 430 3UTR 100% 0.495 0.347 N MOCS2 n/a
8 TRCN0000291640 CCCTATTTGTAGGGACTACAA pLKO_005 430 3UTR 100% 0.495 0.347 N MOCS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176806.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.