Transcript: Human NM_176810.2

Homo sapiens NLR family pyrin domain containing 13 (NLRP13), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
NLRP13 (126204)
Length:
3157
CDS:
26..3157

Additional Resources:

NCBI RefSeq record:
NM_176810.2
NBCI Gene record:
NLRP13 (126204)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_176810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165656 GTCCAGAAACTGACGTGCAAA pLKO.1 2294 CDS 100% 4.950 6.930 N NLRP13 n/a
2 TRCN0000165900 GTTGGCCTAAAGACCACGTAT pLKO.1 612 CDS 100% 4.950 6.930 N NLRP13 n/a
3 TRCN0000159541 CGTATCTTTGAAGTTGACCTT pLKO.1 1994 CDS 100% 2.640 3.696 N NLRP13 n/a
4 TRCN0000161153 CCAGAGAAGCTCCTGTTTATT pLKO.1 932 CDS 100% 15.000 10.500 N NLRP13 n/a
5 TRCN0000162405 CCAGGGTAATGGAGGAATTAT pLKO.1 1854 CDS 100% 15.000 10.500 N NLRP13 n/a
6 TRCN0000166363 CCCAGGGTAATGGAGGAATTA pLKO.1 1853 CDS 100% 13.200 9.240 N NLRP13 n/a
7 TRCN0000159471 CCTTTGAATCTGTCCTTTCTT pLKO.1 218 CDS 100% 5.625 3.938 N NLRP13 n/a
8 TRCN0000161923 GAGAGATCTTAAGGCCTCATT pLKO.1 1129 CDS 100% 4.950 3.465 N NLRP13 n/a
9 TRCN0000166192 CCCATCTGAACTTCAGCTCTA pLKO.1 2379 CDS 100% 4.050 2.835 N NLRP13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.