Transcript: Human NM_176812.5

Homo sapiens charged multivesicular body protein 4B (CHMP4B), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CHMP4B (128866)
Length:
1602
CDS:
122..796

Additional Resources:

NCBI RefSeq record:
NM_176812.5
NBCI Gene record:
CHMP4B (128866)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_176812.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437671 GTTCCATCGCTTTCGACTCTC pLKO_005 894 3UTR 100% 4.050 5.670 N CHMP4B n/a
2 TRCN0000180330 CGGCACATTATCAACCATCGA pLKO.1 370 CDS 100% 2.640 3.696 N CHMP4B n/a
3 TRCN0000150181 GCAGTTGAAATGACCTGAAAT pLKO.1 1132 3UTR 100% 13.200 9.240 N CHMP4B n/a
4 TRCN0000419575 GTATTTGCAAATCCAACATTG pLKO_005 1053 3UTR 100% 10.800 7.560 N CHMP4B n/a
5 TRCN0000423188 TAGGGTTTGGAGAAGAGTTTG pLKO_005 579 CDS 100% 10.800 7.560 N CHMP4B n/a
6 TRCN0000438183 GGAAATCAGTGGACCCGAAAC pLKO_005 664 CDS 100% 6.000 4.200 N CHMP4B n/a
7 TRCN0000148126 GATGAGTTAATGCAGGACATT pLKO.1 506 CDS 100% 4.950 3.465 N CHMP4B n/a
8 TRCN0000414814 GCGTAAGAAGAGGTATGAGAA pLKO_005 331 CDS 100% 4.950 3.465 N CHMP4B n/a
9 TRCN0000147769 GTTAAGCAAGAAACAGGAGTT pLKO.1 226 CDS 100% 4.050 2.835 N CHMP4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176812.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.