Transcript: Mouse NM_176846.3

Mus musculus exophilin 5 (Exph5), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Exph5 (320051)
Length:
9601
CDS:
64..5946

Additional Resources:

NCBI RefSeq record:
NM_176846.3
NBCI Gene record:
Exph5 (320051)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176846.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192706 GCTGGACTTCGTATAGCAATA pLKO.1 5555 CDS 100% 10.800 15.120 N Exph5 n/a
2 TRCN0000246847 TACCGTCAGAGTAACCCATTT pLKO_005 1399 CDS 100% 0.000 0.000 N Exph5 n/a
3 TRCN0000246849 AGATTGGCAGCCATATCTAAA pLKO_005 4786 CDS 100% 13.200 10.560 N Exph5 n/a
4 TRCN0000246846 TTGAGGTGGTTTCAATCTATT pLKO_005 3770 CDS 100% 13.200 10.560 N Exph5 n/a
5 TRCN0000193068 CGGATCAAGAACACAGTTCAA pLKO.1 762 CDS 100% 4.950 3.960 N Exph5 n/a
6 TRCN0000246850 GAGAGTTCAAACACCATTAAA pLKO_005 2554 CDS 100% 15.000 10.500 N Exph5 n/a
7 TRCN0000215915 CTCTAATGACTTACCTGATTT pLKO.1 2247 CDS 100% 13.200 9.240 N Exph5 n/a
8 TRCN0000246848 GTAGATGAGGACCCTTATTTG pLKO_005 1873 CDS 100% 13.200 9.240 N Exph5 n/a
9 TRCN0000191192 CACTTCCTAATGCTTTAGAAA pLKO.1 3893 CDS 100% 5.625 3.375 N Exph5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176846.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.