Transcript: Mouse NM_176902.3

Mus musculus UBA-like domain containing 2 (Ubald2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ubald2 (319370)
Length:
1498
CDS:
216..710

Additional Resources:

NCBI RefSeq record:
NM_176902.3
NBCI Gene record:
Ubald2 (319370)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176902.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328738 CCCATTGCTGGTAGACAATTT pLKO_005 1196 3UTR 100% 13.200 6.600 Y Ubald2 n/a
2 TRCN0000328739 CCCAACTTCCCTGATGCATTG pLKO_005 432 CDS 100% 6.000 3.000 Y Ubald2 n/a
3 TRCN0000189766 GCCCTAAGCACGTTCTTTCAA pLKO.1 339 CDS 100% 5.625 2.813 Y Ubald2 n/a
4 TRCN0000328737 ACCACCCGCAGATGATGTGTA pLKO_005 385 CDS 100% 4.950 2.475 Y Ubald2 n/a
5 TRCN0000190280 CCTAAGCACGTTCTTTCAAGA pLKO.1 341 CDS 100% 4.950 2.475 Y Ubald2 n/a
6 TRCN0000140923 CCAGGTCATGATCAACCAGTT pLKO.1 245 CDS 100% 4.050 2.025 Y UBALD2 n/a
7 TRCN0000189490 CCATGTTCTCCAAGCTTCGAA pLKO.1 454 CDS 100% 3.000 1.500 Y Ubald2 n/a
8 TRCN0000328674 CCATGTTCTCCAAGCTTCGAA pLKO_005 454 CDS 100% 3.000 1.500 Y Ubald2 n/a
9 TRCN0000201787 GCACGTTCTTTCAAGAAAGCA pLKO.1 346 CDS 100% 3.000 1.500 Y Ubald2 n/a
10 TRCN0000328666 GCACGTTCTTTCAAGAAAGCA pLKO_005 346 CDS 100% 3.000 1.500 Y Ubald2 n/a
11 TRCN0000139207 CATGATCAACCAGTTCGTGCT pLKO.1 251 CDS 100% 2.160 1.080 Y UBALD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176902.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.