Transcript: Mouse NM_176913.4

Mus musculus dipeptidase 2 (Dpep2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Dpep2 (319446)
Length:
1878
CDS:
30..1766

Additional Resources:

NCBI RefSeq record:
NM_176913.4
NBCI Gene record:
Dpep2 (319446)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176913.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032493 CATCGGAATTGGCGGAGATTA pLKO.1 1370 CDS 100% 13.200 18.480 N Dpep2 n/a
2 TRCN0000032489 GCAACCCTTTAGCCAATGTAT pLKO.1 1264 CDS 100% 5.625 7.875 N Dpep2 n/a
3 TRCN0000032490 CGCTTAGGTATGATGGTTGAT pLKO.1 1056 CDS 100% 4.950 6.930 N Dpep2 n/a
4 TRCN0000032492 CCTCGCCTGAAATTGAAGCAT pLKO.1 210 CDS 100% 3.000 4.200 N Dpep2 n/a
5 TRCN0000032491 GCCTCTTATTCTGAGCTGGAA pLKO.1 774 CDS 100% 2.640 3.696 N Dpep2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176913.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.