Transcript: Mouse NM_176920.4

Mus musculus leucine-rich repeats and transmembrane domains 1 (Lrtm1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lrtm1 (319476)
Length:
7318
CDS:
360..1430

Additional Resources:

NCBI RefSeq record:
NM_176920.4
NBCI Gene record:
Lrtm1 (319476)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176920.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173962 GACTTCCACATTTGCGGGTTT pLKO.1 682 CDS 100% 4.050 5.670 N Lrtm1 n/a
2 TRCN0000175029 GATGGGAAGTAAGGAACTTAT pLKO.1 1391 CDS 100% 13.200 9.240 N Lrtm1 n/a
3 TRCN0000194201 GTCTGAGAAGATGGGAAGTAA pLKO.1 1382 CDS 100% 5.625 3.938 N Lrtm1 n/a
4 TRCN0000193410 CTTTCTATGGACTTCCACATT pLKO.1 673 CDS 100% 4.950 3.465 N Lrtm1 n/a
5 TRCN0000175113 GCTCTTGCATTTCAATCTGTA pLKO.1 594 CDS 100% 4.950 3.465 N Lrtm1 n/a
6 TRCN0000194567 CCAAACCCAAACCAAAGCCAA pLKO.1 1210 CDS 100% 2.640 1.584 N Lrtm1 n/a
7 TRCN0000193252 CTTTCCATAGAAAGCAGCTTT pLKO.1 726 CDS 100% 0.495 0.297 N Lrtm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176920.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.