Transcript: Mouse NM_176922.5

Mus musculus integrin alpha 11 (Itga11), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Itga11 (319480)
Length:
4937
CDS:
91..3657

Additional Resources:

NCBI RefSeq record:
NM_176922.5
NBCI Gene record:
Itga11 (319480)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176922.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417711 ACGGCATTTGGCATTGAATTT pLKO_005 814 CDS 100% 13.200 18.480 N ITGA11 n/a
2 TRCN0000065851 CCGCCCTGTAGTTCAAATCAA pLKO.1 1995 CDS 100% 5.625 7.875 N Itga11 n/a
3 TRCN0000065848 GCACGGCATTTGGCATTGAAT pLKO.1 812 CDS 100% 5.625 7.875 N Itga11 n/a
4 TRCN0000065850 CCAACAAGAATGAGACCTCTT pLKO.1 1154 CDS 100% 4.050 2.835 N Itga11 n/a
5 TRCN0000065852 CCTTCAATATGGATACCAGAA pLKO.1 155 CDS 100% 4.050 2.835 N Itga11 n/a
6 TRCN0000065849 GCTGATGTTGAGGGACTTCTT pLKO.1 3147 CDS 100% 4.950 2.970 N Itga11 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4512 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176922.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.