Transcript: Mouse NM_177005.4

Mus musculus glycosyltransferase 1 domain containing 1 (Glt1d1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Glt1d1 (319804)
Length:
1559
CDS:
23..1063

Additional Resources:

NCBI RefSeq record:
NM_177005.4
NBCI Gene record:
Glt1d1 (319804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177005.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413493 AGACGAACTTGGAGGATTAAA pLKO_005 1044 CDS 100% 15.000 21.000 N Glt1d1 n/a
2 TRCN0000443291 ACTCAGTCCCAGAGGTGTTTA pLKO_005 1293 3UTR 100% 13.200 9.240 N Glt1d1 n/a
3 TRCN0000422373 ATGCAACTGGGAAGATCTTTG pLKO_005 402 CDS 100% 10.800 7.560 N Glt1d1 n/a
4 TRCN0000421819 CATCTTGGAGGCAATGGATTT pLKO_005 793 CDS 100% 10.800 7.560 N Glt1d1 n/a
5 TRCN0000189656 CTTCTGCAAGGTCACAGCATT pLKO.1 230 CDS 100% 4.950 3.465 N Glt1d1 n/a
6 TRCN0000191947 GACTTAAATGAAGATGCCAAT pLKO.1 278 CDS 100% 4.050 2.835 N Glt1d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177005.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.