Transcript: Mouse NM_177016.3

Mus musculus solute carrier family 17 (sodium phosphate), member 4 (Slc17a4), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Slc17a4 (319848)
Length:
2483
CDS:
119..1597

Additional Resources:

NCBI RefSeq record:
NM_177016.3
NBCI Gene record:
Slc17a4 (319848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177016.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423306 ATCCACAGTAATGGCATATAC pLKO_005 1027 CDS 100% 13.200 18.480 N Slc17a4 n/a
2 TRCN0000429169 TGGCTCAGGTTATGGTATTAA pLKO_005 627 CDS 100% 15.000 12.000 N Slc17a4 n/a
3 TRCN0000435293 GCCCTCGGATGGCCTTATATA pLKO_005 776 CDS 100% 15.000 10.500 N Slc17a4 n/a
4 TRCN0000101961 CCAAGAACAATCCTTCAAGAA pLKO.1 178 CDS 100% 4.950 3.465 N Slc17a4 n/a
5 TRCN0000101964 GCCATGGTGAATACCACAGTA pLKO.1 296 CDS 100% 4.950 3.465 N Slc17a4 n/a
6 TRCN0000101962 CCAACAAATGAACTTGAGCTT pLKO.1 265 CDS 100% 2.640 1.848 N Slc17a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177016.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.