Transcript: Mouse NM_177056.4

Mus musculus transmembrane protein 198 (Tmem198), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tmem198 (319998)
Length:
2199
CDS:
394..1476

Additional Resources:

NCBI RefSeq record:
NM_177056.4
NBCI Gene record:
Tmem198 (319998)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177056.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250582 TGCCCATCAAACGCTTCAATG pLKO_005 1301 CDS 100% 10.800 15.120 N Tmem198 n/a
2 TRCN0000439916 TGCCCATCAAACGCTTCAATG pLKO_005 1301 CDS 100% 10.800 15.120 N TMEM198 n/a
3 TRCN0000250583 ACTAGGCTCTGCACCCTATTA pLKO_005 795 CDS 100% 13.200 10.560 N Tmem198 n/a
4 TRCN0000265276 CAGACACGGACTATGAGTATG pLKO_005 1406 CDS 100% 10.800 8.640 N Tmem198 n/a
5 TRCN0000250581 GAGTCGTCTACTGCTTCTTTG pLKO_005 539 CDS 100% 10.800 7.560 N Tmem198 n/a
6 TRCN0000250584 TGCTCTATCTTCCAATCATTC pLKO_005 1899 3UTR 100% 10.800 7.560 N Tmem198 n/a
7 TRCN0000189983 GAGCTCTCTGAGTTCCTTCAT pLKO.1 1374 CDS 100% 4.950 3.465 N Tmem198 n/a
8 TRCN0000164515 CATGTGCTGTTTGTTTGGAGT pLKO.1 522 CDS 100% 2.640 1.848 N TMEM198 n/a
9 TRCN0000165498 GCTGTTTGTTTGGAGTCGTCT pLKO.1 527 CDS 100% 2.640 1.848 N TMEM198 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177056.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.