Transcript: Mouse NM_177084.3

Mus musculus solute carrier family 9 (sodium/hydrogen exchanger), member 4 (Slc9a4), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Slc9a4 (110895)
Length:
3822
CDS:
290..2683

Additional Resources:

NCBI RefSeq record:
NM_177084.3
NBCI Gene record:
Slc9a4 (110895)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420158 GGAGAGCAATCAGCGTATTTA pLKO_005 1476 CDS 100% 15.000 21.000 N Slc9a4 n/a
2 TRCN0000068138 CGGCAACTTTAGTAGTTACAT pLKO.1 1650 CDS 100% 5.625 7.875 N Slc9a4 n/a
3 TRCN0000068142 CGTTTATGGAACTGGTTACTA pLKO.1 317 CDS 100% 5.625 4.500 N Slc9a4 n/a
4 TRCN0000427097 CCATAGGAAATAGCTTATTAT pLKO_005 2671 CDS 100% 15.000 10.500 N Slc9a4 n/a
5 TRCN0000068140 CCTGCTACACAATCTGCTATT pLKO.1 865 CDS 100% 10.800 7.560 N Slc9a4 n/a
6 TRCN0000068139 CGGCATCATATTTGGATTCAT pLKO.1 1129 CDS 100% 5.625 3.938 N Slc9a4 n/a
7 TRCN0000068141 CCAGACATCATACACGACCAT pLKO.1 1321 CDS 100% 2.640 1.848 N Slc9a4 n/a
8 TRCN0000437787 AGAGCTTCACAGCCGTCTTAT pLKO_005 1762 CDS 100% 13.200 7.920 N Slc9a4 n/a
9 TRCN0000148278 CGTCTTCATGTTCAGCTATTT pLKO.1 1204 CDS 100% 13.200 10.560 N SLC9A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.