Transcript: Mouse NM_177111.3

Mus musculus coiled-coil domain containing 66 (Ccdc66), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ccdc66 (320234)
Length:
2951
CDS:
29..2836

Additional Resources:

NCBI RefSeq record:
NM_177111.3
NBCI Gene record:
Ccdc66 (320234)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177111.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215849 CGAACAAATGAGATCTATTAT pLKO.1 2540 CDS 100% 15.000 21.000 N Ccdc66 n/a
2 TRCN0000216852 GGTGCACAAGTGGATTATAAG pLKO.1 1727 CDS 100% 13.200 18.480 N Ccdc66 n/a
3 TRCN0000192743 GCAGACAGATGACGTAAACTT pLKO.1 1834 CDS 100% 5.625 7.875 N Ccdc66 n/a
4 TRCN0000191949 GAAACGAATCTCATACCCTTA pLKO.1 2777 CDS 100% 4.050 5.670 N Ccdc66 n/a
5 TRCN0000217446 GACTTTAGGAGATGGTCATAC pLKO.1 2470 CDS 100% 10.800 8.640 N Ccdc66 n/a
6 TRCN0000192494 CGGTAACAGAGAAGGGTATTA pLKO.1 1890 CDS 100% 13.200 9.240 N Ccdc66 n/a
7 TRCN0000215671 GATCCACTTCTTAATCCTAAA pLKO.1 2669 CDS 100% 10.800 7.560 N Ccdc66 n/a
8 TRCN0000191598 GCTATTTGACTCTGACCATAT pLKO.1 2644 CDS 100% 10.800 7.560 N Ccdc66 n/a
9 TRCN0000200694 GAACTCAACAAACTCAAAGTA pLKO.1 2400 CDS 100% 5.625 3.938 N Ccdc66 n/a
10 TRCN0000192663 GCTTCACTTAGTGGAGAGAAA pLKO.1 2212 CDS 100% 4.950 3.465 N Ccdc66 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177111.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.