Transcript: Mouse NM_177124.4

Mus musculus trinucleotide repeat containing 6b (Tnrc6b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Tnrc6b (213988)
Length:
17125
CDS:
191..5515

Additional Resources:

NCBI RefSeq record:
NM_177124.4
NBCI Gene record:
Tnrc6b (213988)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177124.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144606 GCAATCAAATGAAGTCTGGAT pLKO.1 2211 CDS 100% 2.640 3.696 N TNRC6B n/a
2 TRCN0000139185 CGATAACAACAGTGCCTCGAA pLKO.1 841 CDS 100% 2.640 2.112 N TNRC6B n/a
3 TRCN0000124881 GCTGAGTCAAACTGAGGATAA pLKO.1 3397 CDS 100% 10.800 7.560 N Tnrc6b n/a
4 TRCN0000124882 CCACAGTCAATTAGTCGGAAA pLKO.1 2822 CDS 100% 4.050 2.835 N Tnrc6b n/a
5 TRCN0000124883 GCAACCACAAAGCAGGAAGTA pLKO.1 1920 CDS 100% 4.950 2.475 Y Tnrc6b n/a
6 TRCN0000122414 GCCTCAATGCTCAAGCAGTTT pLKO.1 3716 CDS 100% 4.950 6.930 N TNRC6B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177124.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.