Transcript: Mouse NM_177140.3

Mus musculus transmembrane protein 251 (Tmem251), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tmem251 (320351)
Length:
1205
CDS:
328..819

Additional Resources:

NCBI RefSeq record:
NM_177140.3
NBCI Gene record:
Tmem251 (320351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177140.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194174 GCTTGTAACCTGCAGTCTTTA pLKO.1 1044 3UTR 100% 13.200 18.480 N Tmem251 n/a
2 TRCN0000193814 CCTTGAAAGCTCGGTTACTTT pLKO.1 596 CDS 100% 5.625 7.875 N Tmem251 n/a
3 TRCN0000175936 GCAGTTATCTGCAATCGTCAT pLKO.1 742 CDS 100% 4.050 5.670 N Tmem251 n/a
4 TRCN0000174855 GCATTTGTCAAGGCTTCTAAT pLKO.1 766 CDS 100% 13.200 10.560 N Tmem251 n/a
5 TRCN0000193444 GACTGACTACTTTATCTGAAT pLKO.1 944 3UTR 100% 4.950 3.960 N Tmem251 n/a
6 TRCN0000216097 CTTGATTCCGTACTTACAGAT pLKO.1 648 CDS 100% 4.950 3.465 N Tmem251 n/a
7 TRCN0000176112 GACTTACAACAGGTTGGCTTT pLKO.1 519 CDS 100% 4.050 2.835 N Tmem251 n/a
8 TRCN0000194088 GCTTCTAATCAGATCAGCAGA pLKO.1 778 CDS 100% 2.640 1.848 N Tmem251 n/a
9 TRCN0000217568 GAGCATGGAGAATGATGAACT pLKO.1 413 CDS 100% 4.950 2.970 N Tmem251 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177140.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.