Transcript: Mouse NM_177192.3

Mus musculus DENN/MADD domain containing 5B (Dennd5b), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Dennd5b (320560)
Length:
9833
CDS:
372..4196

Additional Resources:

NCBI RefSeq record:
NM_177192.3
NBCI Gene record:
Dennd5b (320560)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177192.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110177 CGGACATCTATATATCAGAAA pLKO.1 2190 CDS 100% 4.950 6.930 N Dennd5b n/a
2 TRCN0000110178 GCGATACAACTCTTATGACAT pLKO.1 893 CDS 100% 4.950 6.930 N Dennd5b n/a
3 TRCN0000110175 CGGGTCTTTGATTCTCGGATT pLKO.1 2130 CDS 100% 4.050 5.670 N Dennd5b n/a
4 TRCN0000110179 CGTGGATATTGACAACCATTT pLKO.1 1478 CDS 100% 10.800 7.560 N Dennd5b n/a
5 TRCN0000110176 GCGGACATCTATATATCAGAA pLKO.1 2189 CDS 100% 4.950 3.465 N Dennd5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177192.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.