Transcript: Mouse NM_177213.3

Mus musculus ATP-binding cassette, sub-family A (ABC1), member 15 (Abca15), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Abca15 (320631)
Length:
5335
CDS:
163..5169

Additional Resources:

NCBI RefSeq record:
NM_177213.3
NBCI Gene record:
Abca15 (320631)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177213.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113431 GCGCCAATCTTCCAATACAAT pLKO.1 1153 CDS 100% 5.625 7.875 N Abca15 n/a
2 TRCN0000113430 TCCTTGAGATTCCGTTACAAA pLKO.1 5185 3UTR 100% 5.625 7.875 N Abca15 n/a
3 TRCN0000113432 CCACTAATTCTGGCTGTGAAA pLKO.1 4261 CDS 100% 4.950 3.960 N Abca15 n/a
4 TRCN0000113433 CGCCATCATTATAGCCCTGAT pLKO.1 2157 CDS 100% 4.050 2.835 N Abca15 n/a
5 TRCN0000113434 CCACCTTCTTAGTATAAAGAA pLKO.1 297 CDS 100% 0.563 0.394 N Abca15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177213.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.