Transcript: Mouse NM_177235.3

Mus musculus BEN domain containing 6 (Bend6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Bend6 (320705)
Length:
2318
CDS:
145..990

Additional Resources:

NCBI RefSeq record:
NM_177235.3
NBCI Gene record:
Bend6 (320705)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177235.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217708 GCAGATTGCCCGTTGTAATAA pLKO.1 681 CDS 100% 15.000 21.000 N Bend6 n/a
2 TRCN0000192417 CCGACAACCAAGTTCTTAGAA pLKO.1 176 CDS 100% 5.625 7.875 N Bend6 n/a
3 TRCN0000134811 CCAGCTATGAATCAGAATGAA pLKO.1 820 CDS 100% 5.625 4.500 N BEND6 n/a
4 TRCN0000215348 CAGATGTGTAATAGTAGATAA pLKO.1 1661 3UTR 100% 13.200 9.240 N Bend6 n/a
5 TRCN0000216406 GATTTAATGCAAGTACTTTAC pLKO.1 727 CDS 100% 10.800 7.560 N Bend6 n/a
6 TRCN0000192108 CAAGGTTGTCAAACCAGCTAT pLKO.1 807 CDS 100% 4.950 3.465 N Bend6 n/a
7 TRCN0000191291 CCGTTTGAGTTATTCTGTGAT pLKO.1 1441 3UTR 100% 4.950 3.465 N Bend6 n/a
8 TRCN0000192565 GCAGTCACACAGTTTGAAGAA pLKO.1 454 CDS 100% 4.950 3.465 N Bend6 n/a
9 TRCN0000189767 GCGAATAGTGCTCTGGAGAAA pLKO.1 238 CDS 100% 4.950 3.465 N Bend6 n/a
10 TRCN0000202340 GCTTCGACAGTCTTTGGTCAT pLKO.1 414 CDS 100% 4.050 2.835 N Bend6 n/a
11 TRCN0000138565 CGACAGTCTTTGGTCATGCTT pLKO.1 418 CDS 100% 3.000 2.100 N BEND6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177235.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.