Transcript: Mouse NM_177240.3

Mus musculus trafficking protein particle complex 11 (Trappc11), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Trappc11 (320714)
Length:
4338
CDS:
175..3576

Additional Resources:

NCBI RefSeq record:
NM_177240.3
NBCI Gene record:
Trappc11 (320714)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177240.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176547 CTAATGAATGAGATGTACTGT pLKO.1 2467 CDS 100% 3.000 2.400 N Trappc11 n/a
2 TRCN0000198047 CATTTCCAGAGTCCCAAACAT pLKO.1 2415 CDS 100% 5.625 3.938 N Trappc11 n/a
3 TRCN0000181870 GATCACCTCTGTGGATCTGTT pLKO.1 2223 CDS 100% 4.950 3.465 N Trappc11 n/a
4 TRCN0000198639 CAGAGTCCCAAACATCTCTGT pLKO.1 2421 CDS 100% 0.264 0.185 N Trappc11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177240.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.