Transcript: Mouse NM_177244.3

Mus musculus FAST kinase domains 1 (Fastkd1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Fastkd1 (320720)
Length:
2877
CDS:
146..2635

Additional Resources:

NCBI RefSeq record:
NM_177244.3
NBCI Gene record:
Fastkd1 (320720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177323 GTTTGACCTTATTGAGACGAA pLKO.1 259 CDS 100% 2.640 3.696 N Fastkd1 n/a
2 TRCN0000178716 CCCTTCAGTTGTGAGTCATTA pLKO.1 200 CDS 100% 13.200 10.560 N Fastkd1 n/a
3 TRCN0000328436 CCCTTCAGTTGTGAGTCATTA pLKO_005 200 CDS 100% 13.200 10.560 N Fastkd1 n/a
4 TRCN0000328370 TTCCGCTCTTTCACCGTATTA pLKO_005 2263 CDS 100% 13.200 10.560 N Fastkd1 n/a
5 TRCN0000328372 ACTAATGTGCTGTCCATATTT pLKO_005 557 CDS 100% 15.000 10.500 N Fastkd1 n/a
6 TRCN0000328371 CAAGTGGGCTGTGCGTTTAAT pLKO_005 302 CDS 100% 15.000 10.500 N Fastkd1 n/a
7 TRCN0000197938 GCTGTGCGTTTAATGTACTTT pLKO.1 309 CDS 100% 5.625 3.938 N Fastkd1 n/a
8 TRCN0000353355 CTGCTCTTGCAGAGATCCTAA pLKO_005 2701 3UTR 100% 4.950 2.970 N Fastkd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.