Transcript: Mouse NM_177321.2

Mus musculus melanoma inhibitory activity 2 (Mia2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mia2 (338320)
Length:
1628
CDS:
1..1554

Additional Resources:

NCBI RefSeq record:
NM_177321.2
NBCI Gene record:
Mia2 (338320)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416353 CAATCCACCATTACAAGATAT pLKO_005 996 CDS 100% 13.200 18.480 N Mia2 n/a
2 TRCN0000424558 GATTTGGTATGCTAGGCTTTA pLKO_005 1136 CDS 100% 10.800 15.120 N Mia2 n/a
3 TRCN0000191529 GAAGAACATATGTACCCATAT pLKO.1 412 CDS 100% 0.000 0.000 N Mia2 n/a
4 TRCN0000416455 AGTGAACAGAGTGAATTAAAC pLKO_005 379 CDS 100% 13.200 9.240 N Mia2 n/a
5 TRCN0000191687 GAAGTCGAAATGCCAACTAAA pLKO.1 316 CDS 100% 13.200 9.240 N Mia2 n/a
6 TRCN0000431706 GTGAGGGCCTTACAAGTTATT pLKO_005 926 CDS 100% 13.200 9.240 N Mia2 n/a
7 TRCN0000437585 GAATCTGAGACGGAGAGTATC pLKO_005 877 CDS 100% 10.800 7.560 N Mia2 n/a
8 TRCN0000200887 GAGGACACAGAATTACCATTT pLKO.1 1402 CDS 100% 10.800 7.560 N Mia2 n/a
9 TRCN0000412507 GATAACCTCAAACATCCTATA pLKO_005 1216 CDS 100% 10.800 7.560 N Mia2 n/a
10 TRCN0000192180 CGGGAGAAGAGATATCTGTTT pLKO.1 185 CDS 100% 4.950 3.465 N Mia2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.