Transcript: Mouse NM_177351.4

Mus musculus hydroxylysine kinase 1 (Hykk), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Hykk (235386)
Length:
5103
CDS:
575..1705

Additional Resources:

NCBI RefSeq record:
NM_177351.4
NBCI Gene record:
Hykk (235386)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177351.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180332 CCCAGTTGAATATGTCCTCAA pLKO.1 757 CDS 100% 4.050 5.670 N Hykk n/a
2 TRCN0000263414 ATCAGCCACCAGCAATTATAT pLKO_005 998 CDS 100% 15.000 10.500 N Hykk n/a
3 TRCN0000263413 TCTAGTCTAAGTGGCTATTTA pLKO_005 3831 3UTR 100% 15.000 10.500 N Hykk n/a
4 TRCN0000183817 CCACCAGCAATTATATGAAAT pLKO.1 1003 CDS 100% 13.200 9.240 N Hykk n/a
5 TRCN0000180431 GCACTGGTAGAATCGGTATTT pLKO.1 644 CDS 100% 13.200 9.240 N Hykk n/a
6 TRCN0000263415 GCACTGGTAGAATCGGTATTT pLKO_005 644 CDS 100% 13.200 9.240 N Hykk n/a
7 TRCN0000282617 GTTTGAAGTGGCAATCGTTAT pLKO_005 1372 CDS 100% 10.800 7.560 N Hykk n/a
8 TRCN0000129300 CGGGAGAACTTCATCTGGAAT pLKO.1 1094 CDS 100% 4.950 3.465 N HYKK n/a
9 TRCN0000196142 GCACCCACAATGTTCTGGATT pLKO.1 1770 3UTR 100% 4.950 3.465 N Hykk n/a
10 TRCN0000184667 GCATGAGAACACAAGCCGTTA pLKO.1 2233 3UTR 100% 4.050 2.835 N Hykk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177351.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.