Transcript: Mouse NM_177352.4

Mus musculus glycerol kinase 5 (putative) (Gk5), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gk5 (235533)
Length:
2746
CDS:
23..1573

Additional Resources:

NCBI RefSeq record:
NM_177352.4
NBCI Gene record:
Gk5 (235533)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177352.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362140 CTTCCTACGCCACGGATTATT pLKO_005 660 CDS 100% 15.000 21.000 N Gk5 n/a
2 TRCN0000024831 CCGAGCAATATTGGAGTCAAT pLKO.1 1255 CDS 100% 4.950 6.930 N Gk5 n/a
3 TRCN0000024832 GCTGTTATACAAGCTCACGAA pLKO.1 634 CDS 100% 2.640 3.696 N Gk5 n/a
4 TRCN0000024829 CCTGGAATAATTCTCTCATAA pLKO.1 423 CDS 100% 13.200 10.560 N Gk5 n/a
5 TRCN0000024830 GCTCAGTTTGTTGCCGTAATA pLKO.1 242 CDS 100% 13.200 10.560 N Gk5 n/a
6 TRCN0000362220 CTCAGTTTGTTGCCGTAATAA pLKO_005 243 CDS 100% 15.000 10.500 N Gk5 n/a
7 TRCN0000377598 TGGATTACAGGCTCCATTAAA pLKO_005 1171 CDS 100% 15.000 10.500 N GK5 n/a
8 TRCN0000024833 GACCTGATAAATGAGAAGATA pLKO.1 1394 CDS 100% 5.625 3.938 N Gk5 n/a
9 TRCN0000362141 TGAAGGATACCAGCTATAATT pLKO_005 780 CDS 100% 15.000 9.000 N Gk5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177352.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.