Transcript: Mouse NM_177359.5

Mus musculus zinc finger protein 799 (Zfp799), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-23
Taxon:
Mus musculus (mouse)
Gene:
Zfp799 (240064)
Length:
6025
CDS:
171..2117

Additional Resources:

NCBI RefSeq record:
NM_177359.5
NBCI Gene record:
Zfp799 (240064)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177359.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096428 CTTCAATACCACGAGTTGATT pLKO.1 1464 CDS 100% 5.625 7.875 N Zfp799 n/a
2 TRCN0000096425 GCTCCGTTAAGTACCATGAAT pLKO.1 1291 CDS 100% 5.625 7.875 N Zfp799 n/a
3 TRCN0000096426 CCTTCTGTAGTCGCATATCAT pLKO.1 1780 CDS 100% 5.625 4.500 N Zfp799 n/a
4 TRCN0000096427 CCTGTCTATGAAGAAGTAGTT pLKO.1 483 CDS 100% 4.950 3.465 N Zfp799 n/a
5 TRCN0000096424 CGCCCAGTATTCTTACAGAAA pLKO.1 3256 3UTR 100% 4.950 3.465 N Zfp799 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5435 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177359.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.