Transcript: Mouse NM_177366.3

Mus musculus G protein-coupled receptor 157 (Gpr157), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Gpr157 (269604)
Length:
4762
CDS:
252..1244

Additional Resources:

NCBI RefSeq record:
NM_177366.3
NBCI Gene record:
Gpr157 (269604)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231301 CTGGTCAGCTGAGGGTAATAT pLKO_005 1690 3UTR 100% 15.000 21.000 N LOC100045284 n/a
2 TRCN0000028703 CGCTCTCTCTACTTTCGCCAA pLKO.1 500 CDS 100% 2.160 3.024 N Gpr157 n/a
3 TRCN0000231299 CTCCACTTCCACGGCAGATAA pLKO_005 908 CDS 100% 13.200 10.560 N LOC100045284 n/a
4 TRCN0000231297 TTCGTGGGATTGCGTCCTTCA pLKO_005 476 CDS 100% 4.050 3.240 N LOC100045284 n/a
5 TRCN0000231298 GTGGGAGATGCTGGCTTATAT pLKO_005 779 CDS 100% 15.000 10.500 N LOC100045284 n/a
6 TRCN0000231300 TGGTCCTCATTCCGCTCATAT pLKO_005 934 CDS 100% 13.200 9.240 N LOC100045284 n/a
7 TRCN0000028735 GCCGTCTCTCTAAAGAAGATA pLKO.1 666 CDS 100% 5.625 3.938 N Gpr157 n/a
8 TRCN0000028710 GATAAGAAGTTGGTCCTCATT pLKO.1 924 CDS 100% 4.950 3.465 N Gpr157 n/a
9 TRCN0000028679 CTGGTTGTTCTGCATGGCATT pLKO.1 1032 CDS 100% 4.050 2.835 N Gpr157 n/a
10 TRCN0000028719 GCATGGCATTGGAAACACCTT pLKO.1 1043 CDS 100% 2.640 1.848 N Gpr157 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.