Transcript: Mouse NM_177386.5

Mus musculus Scm-like with four mbt domains 2 (Sfmbt2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sfmbt2 (353282)
Length:
7850
CDS:
322..3150

Additional Resources:

NCBI RefSeq record:
NM_177386.5
NBCI Gene record:
Sfmbt2 (353282)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177386.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329354 CGGATGTGGTACGATTCATTA pLKO_005 2945 CDS 100% 13.200 18.480 N Sfmbt2 n/a
2 TRCN0000329285 TTCGTCAACCACCGGTGTTTC pLKO_005 1915 CDS 100% 10.800 15.120 N Sfmbt2 n/a
3 TRCN0000097648 GCAAATGGGAATGGGACTCTT pLKO.1 391 CDS 100% 4.950 6.930 N Sfmbt2 n/a
4 TRCN0000329357 CCTATTTGATAGTCCTATATT pLKO_005 3307 3UTR 100% 15.000 12.000 N Sfmbt2 n/a
5 TRCN0000329356 CCCTCTGACCACACCATATAA pLKO_005 1731 CDS 100% 15.000 10.500 N Sfmbt2 n/a
6 TRCN0000329288 TGGGACCCGCTATCAAGTTAT pLKO_005 3077 CDS 100% 13.200 9.240 N Sfmbt2 n/a
7 TRCN0000097645 CGGATGCTATCAAAGACAAGT pLKO.1 749 CDS 100% 4.950 3.465 N Sfmbt2 n/a
8 TRCN0000097647 ACAGACTTCCTCATCCGTGAA pLKO.1 781 CDS 100% 4.050 2.835 N Sfmbt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177386.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.